|
|
skipseq |
Please help by correcting and extending the Wiki pages.
skipseq is a variant of the standard program for reading and writing sequences, seqret. It performs exactly the same function except that it skips the first specified number of sequences from the input stream and writes out the rest of them. In all other respects, skipseq is the same as seqret. There are many options built-in into EMBOSS for detailed specification of the input and output sequences, for example the sequence type and file format. Optionally, feature information will be read and written.
This does not skip any sequences. It is exactly equivalent to seqret:
% skipseq Reads and writes (returns) sequences, skipping first few Input (gapped) sequence(s): @eclac.list Number of sequences to skip at start [0]: output sequence(s) [j01636.fasta]: |
Go to the input files for this example
Go to the output files for this example
Example 2
This skips the first input sequence, writing out the others:
% skipseq -skip 1 Reads and writes (returns) sequences, skipping first few Input (gapped) sequence(s): @eclac.list output sequence(s) [j01636.fasta]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
-skip integer [0] Number of sequences to skip at start
(Any integer value)
[-outseq] seqoutall [
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
(Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| -skip | Number of sequences to skip at start | Any integer value | 0 |
| [-outseq] (Parameter 2) |
Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -feature | Use feature information | Boolean value Yes/No | No |
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
See the documentation for seqret to see the full range of things that you can do when reading and writing sequences.
>J01636 J01636.1 E.coli lactose operon with lacI, lacZ, lacY and lacA genes. gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt caattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggt gtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacg cgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaa caactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtg gtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatctt ctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccatt gctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagaca cccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctg gtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcg cgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcg gaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaat gagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatg cgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgc ctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaag ggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacg caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcc cgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggc accccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata acaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttac aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatcccc ctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgc gcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaa gctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcaga tgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgc cgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaa gctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatc tgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttg acctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttgga gtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacg tctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgcttta atgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtg actacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccg cgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactac gtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcgg tggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtt tccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattc gaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacga tggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcatt atccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatg aagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgct ggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccga gtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgt atcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccg acaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagccct tcccggctgtgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcc cgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaat [Part of this file has been deleted for brevity] gttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaa gaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcttt gcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgag gccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctac accaacgtaacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacg ggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcga attatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcggt tacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccgga gaaaaccgcctcgcggtgatggtgctgcgttggagtgacggcagttatctggaagatcag gatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactaca caaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactg gaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttcttta tggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgat gagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactg tggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggc acgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggt ctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcat cctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaag cagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacg ctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatg gtgccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgcgta acgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaat gaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatcct tcccgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatttgc ccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatc aaaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcccac gcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatccc cgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaa aacggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgccag ttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagca aaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagc gaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatggt aagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgatt gaactgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgta gtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtgg cgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctg accaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgc cagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctg cgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgc attgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagca gcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgctcac gcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggt agtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcg cggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctg ccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgcggg acgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagc cgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaa ggcacatggctgaatatcgacggtttccatatggggattggtggcgacgactcctggagc ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtctgg tgtcaaaaataataataa |
>X51872 X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc cgcccatggtaaccaccggcagagcggtcgac >V00294 V00294.1 E. coli laci gene (codes for the lac repressor). ccggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgca gagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtt tctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaac cgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagt ctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactg ggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcg gtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgac caggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtc tctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggc gtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagt tctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaatt cagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatg caaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcg ctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggta gtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaa caggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggc caggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctg [Part of this file has been deleted for brevity] gttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaa gaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcttt gcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgag gccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctac accaacgtaacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacg ggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcga attatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcggt tacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccgga gaaaaccgcctcgcggtgatggtgctgcgttggagtgacggcagttatctggaagatcag gatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactaca caaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactg gaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttcttta tggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgat gagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactg tggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggc acgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggt ctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcat cctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaag cagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacg ctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatg gtgccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgcgta acgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaat gaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatcct tcccgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatttgc ccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatc aaaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcccac gcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatccc cgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaa aacggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgccag ttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagca aaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagc gaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatggt aagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgatt gaactgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgta gtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtgg cgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctg accaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgc cagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctg cgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgc attgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagca gcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgctcac gcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggt agtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcg cggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctg ccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgcggg acgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagc cgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaa ggcacatggctgaatatcgacggtttccatatggggattggtggcgacgactcctggagc ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtctgg tgtcaaaaataataataa |
See the documentation for seqret to see the full range of things that you can do when reading and writing sequences.
See the documentation for seqret to see the full range of things that you can do when reading and writing sequences.
seqret has an option to allow it to only read the first sequence from a multiple set of sequences (-firstonly). seqret cannot, however, skip the first few sequences from a multiple set of sequence, writing out the rest; this is what skipseq is for.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
skipseq is a variant of the standard program for reading and writing sequences, seqret.