|   | stssearch | 
stssearchs reads in one or more sequences to be searched. For each pair of primers, it looks for matches between a the primers and the query sequence in either orientation.
Any matches found will be reported. Only one primer need match for it to be reported..
| % stssearch Search a DNA database for matches with a set of STS primers Input nucleotide sequence(s): @eclac.list Primer pairs file: lac.primers Output file [j01636.stssearch]: | 
Go to the input files for this example
Go to the output files for this example
| 
   Standard (Mandatory) qualifiers:
  [-seqall]            seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-infile]            infile     Primer pairs file
  [-outfile]           outfile    [*.stssearch] Output file name
   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:
   "-seqall" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name
   "-outfile" associated qualifiers
   -odirectory3        string     Output directory
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
 | 
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-seqall] (Parameter 1) | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required | 
| [-infile] (Parameter 2) | Primer pairs file | Input file | Required | 
| [-outfile] (Parameter 3) | Output file name | Output file | <*>.stssearch | 
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
| #Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 | 
| PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA | 
The primers file consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
| J01636: PrimA PrimerA matched at 532 J01636: (rev) PrimA PrimerB matched at 689 J01636: PrimB PrimerA matched at 5743 J01636: (rev) PrimB PrimerB matched at 5942 J01636: PrimC PrimerA matched at 2954 J01636: (rev) PrimC PrimerB matched at 3069 J01636: PrimD PrimerA matched at 1074 J01636: (rev) PrimD PrimerB matched at 1261 J01636: PrimE PrimerA matched at 1074 X51872: PrimB PrimerA matched at 98 X51872: (rev) PrimB PrimerB matched at 297 V00294: PrimA PrimerA matched at 484 V00294: (rev) PrimA PrimerB matched at 641 V00294: PrimD PrimerA matched at 1026 V00294: PrimE PrimerA matched at 1026 V00295: PrimB PrimerA matched at 1439 V00296: PrimC PrimerA matched at 1668 V00296: (rev) PrimC PrimerB matched at 1783 | 
The output file consists of one line per match. This consists of:
| Program name | Description | 
|---|---|
| eprimer3 | Picks PCR primers and hybridization oligos | 
| primersearch | Searches DNA sequences for matches with primer pairs | 
If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.